Review





Similar Products

97
TaKaRa primescript high fidelity reverse transcriptase kit
Primescript High Fidelity Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+Reverse+Transcriptase/pm25249323-308-11-17
Average 97 stars, based on 1 article reviews
primescript high fidelity reverse transcriptase kit - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

96
TaKaRa prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit
Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. <t>RT‐PCR</t> and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).
Prime Script Ii High Fidelity Reverse Transcriptase Polymerase Chain Reaction Rt Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primescript+high+fidelity+reverse+transcriptase+kit/PrimeScript+High+Fidelity+RT-PCR+Kit/pmc05101622-85-11-22
Average 96 stars, based on 1 article reviews
prime script ii high fidelity reverse transcriptase polymerase chain reaction rt pcr kit - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. RT‐PCR and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).

Journal: Journal of Biomedical Materials Research. Part a

Article Title: Autocrine fibronectin from differentiating mesenchymal stem cells induces the neurite elongation in vitro and promotes nerve fiber regeneration in transected spinal cord injury

doi: 10.1002/jbm.a.35720

Figure Lengend Snippet: Fibronectin deposition on the surface of gelatin material after co‐culture of MSCs and SCs. ECM accumulation is significant in gelatin sponge (GS) in the MSCs group (A), as evidenced by the rough surface (inset in A), while the surface of GS without MSCs is smooth (inset in B). FN, secreted by GFP positive MSCs (arrowheads in C), deposits onto the surface of gelatin material and displays thread‐like red fluorescence (arrows in C). Application of FN antibody decreases the deposition of FN onto the surface of gelatin material. Three dimensional reconstructive image shows that the surface of gelatin material is decorated by adherent FN (blue, in D). After adding FN blocking antibody (FNab) to the culture medium, deposition of FN (blue) onto the surface is obviously reduced as shown in (E). Green cells in D and E are MSCs. RT‐PCR and Western blot results indicate that, although the transcriptional level of FN decreases with the increase in duration of co‐culture (F), the amount of FN protein increases within the gelatin sponge (GS) scaffolds (G,H). Scale bars: 200 μm in (A,B), 20 μm in the inset of (A,B), and 20 μm in (C–E).

Article Snippet: Then, using each synthesized cDNA as a mould, PCR by using Prime Script II High Fidelity Reverse transcriptase‐polymerase chain reaction (RT‐PCR) Kit (Takara) was per formed with the FN primers with Forward strand: 5′‐GGCTCAATCCAAATGCCTCTAC‐3′ and Reverse strand: 5′‐CCCTCTGGTAAGGCCAGTCAG‐3′, while β‐actin with Forward strand: 5′‐AGAGGGAAATCGTGCGTGAC‐3′ and Reverse strand: 5′‐AGAGGTCTTTACGGATGTCAACG‐3′ as loading reference.

Techniques: Co-Culture Assay, Fluorescence, Blocking Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot